Hospital strains of microorganisms. Hospital strain of the pathogen
– various infectious diseases contracted in a medical facility. Depending on the degree of spread, generalized (bacteremia, septicemia, septicopyemia, bacterial shock) and localized forms of nosocomial infections (with damage to the skin and subcutaneous tissue, respiratory, cardiovascular, urogenital system, bones and joints, central nervous system, etc.) are distinguished. . Identification of pathogens of nosocomial infections is carried out using laboratory diagnostic methods (microscopic, microbiological, serological, molecular biological). In the treatment of nosocomial infections, antibiotics, antiseptics, immunostimulants, physiotherapy, extracorporeal hemocorrection, etc. are used.
General information
Nosocomial (hospital, nosocomial) infections are infectious diseases of various etiologies that arose in a patient or medical employee in connection with their stay in a medical institution. An infection is considered nosocomial if it develops no earlier than 48 hours after the patient’s admission to the hospital. The prevalence of nosocomial infections (HAIs) in medical institutions of various profiles is 5-12%. The largest share of nosocomial infections occurs in obstetric and surgical hospitals (intensive care units, abdominal surgery, traumatology, burn trauma, urology, gynecology, otolaryngology, dentistry, oncology, etc.). Nosocomial infections represent a major medical and social problem, since they aggravate the course of the underlying disease, increase the duration of treatment by 1.5 times, and the number of deaths by 5 times.
Etiology and epidemiology of nosocomial infections
The main causative agents of nosocomial infections (85% of the total) are opportunistic microorganisms: gram-positive cocci (epidermal and Staphylococcus aureus, beta-hemolytic streptococcus, pneumococcus, enterococcus) and gram-negative rod-shaped bacteria (Klebsiella, Escherichia, Enterobacter, Proteus, Pseudomonas, etc. .). In addition, in the etiology of nosocomial infections, the specific role of viral pathogens of herpes simplex, adenovirus infection, influenza, parainfluenza, cytomegaly, viral hepatitis, respiratory syncytial infection, as well as rhinoviruses, rotaviruses, enteroviruses, etc., is great. Nosocomial infections can also be caused by conditionally pathogenic and pathogenic fungi (yeast-like, mold, radiata). A feature of intrahospital strains of opportunistic microorganisms is their high variability, drug resistance and resistance to environmental factors (ultraviolet radiation, disinfectants, etc.).
The sources of nosocomial infections in most cases are patients or medical personnel who are bacteria carriers or patients with erased and manifest forms of pathology. Research shows that the role of third parties (in particular, hospital visitors) in the spread of nosocomial infections is small. Transmission of various forms of hospital infection is realized through airborne droplets, fecal-oral, contact, and transmissible mechanisms. In addition, a parenteral route of transmission of nosocomial infection is possible during various invasive medical procedures: blood sampling, injections, vaccinations, instrumental manipulations, operations, mechanical ventilation, hemodialysis, etc. Thus, in a medical institution it is possible to become infected with hepatitis, and purulent-inflammatory diseases, syphilis , HIV infection. There are known cases of nosocomial outbreaks of legionellosis when patients took medicinal showers and whirlpool baths.
Factors involved in the spread of nosocomial infection may include contaminated care items and furnishings, medical instruments and equipment, solutions for infusion therapy, overalls and hands of medical staff, reusable medical products (probes, catheters, endoscopes), drinking water, bedding, suture and dressing material and many others. etc.
The significance of certain types of nosocomial infections largely depends on the profile of the medical institution. Thus, in burn departments, Pseudomonas aeruginosa infection predominates, which is mainly transmitted through care items and the hands of staff, and the main source of nosocomial infection is the patients themselves. In maternity care facilities, the main problem is staphylococcal infection, spread by medical personnel carrying Staphylococcus aureus. In urology departments, infections caused by gram-negative flora dominate: intestinal, Pseudomonas aeruginosa, etc. In pediatric hospitals, the problem of the spread of childhood infections - chickenpox, mumps, rubella, measles - is of particular importance. The emergence and spread of nosocomial infection is facilitated by violation of the sanitary and epidemiological regime of health care facilities (failure to comply with personal hygiene, asepsis and antiseptics, disinfection and sterilization regime, untimely identification and isolation of persons who are sources of infection, etc.).
The risk group most susceptible to the development of nosocomial infections includes newborns (especially premature babies) and young children; elderly and frail patients; persons suffering from chronic diseases (diabetes mellitus, blood diseases, renal failure), immunodeficiency, oncology. A person's susceptibility to hospital-acquired infections increases with the presence of open wounds, abdominal drainages, intravascular and urinary catheters, tracheostomy and other invasive devices. The incidence and severity of nosocomial infections are influenced by the patient's long stay in the hospital, long-term antibiotic therapy, and immunosuppressive therapy.
Classification of nosocomial infections
According to the duration of their course, nosocomial infections are divided into acute, subacute and chronic; according to the severity of clinical manifestations - into mild, moderate and severe forms. Depending on the degree of prevalence of the infectious process, generalized and localized forms of nosocomial infection are distinguished. Generalized infections are represented by bacteremia, septicemia, bacterial shock. In turn, among the localized forms there are:
- infections of the skin, mucous membranes and subcutaneous tissue, including postoperative, burn, and traumatic wounds. In particular, these include omphalitis, abscesses and phlegmon, pyoderma, erysipelas, mastitis, paraproctitis, fungal infections of the skin, etc.
- infections of the oral cavity (stomatitis) and ENT organs (tonsillitis, pharyngitis, laryngitis, epiglottitis, rhinitis, sinusitis, otitis media, mastoiditis)
- infections of the bronchopulmonary system (bronchitis, pneumonia, pleurisy, lung abscess, lung gangrene, pleural empyema, mediastinitis)
- infections of the digestive system (gastritis, enteritis, colitis, viral hepatitis)
- eye infections (blepharitis, conjunctivitis, keratitis)
- infections of the urogenital tract (bacteriuria, urethritis, cystitis, pyelonephritis, endometritis, adnexitis)
- infections of the musculoskeletal system (bursitis, arthritis, osteomyelitis)
- infections of the heart and blood vessels (pericarditis, myocarditis, endocarditis, thrombophlebitis).
- CNS infections (brain abscess, meningitis, myelitis, etc.).
In the structure of nosocomial infections, purulent-septic diseases account for 75-80%, intestinal infections - 8-12%, blood-contact infections - 6-7%. Other infectious diseases (rotavirus infections, diphtheria, tuberculosis, mycoses, etc.) account for about 5-6%.
Diagnosis of nosocomial infections
The criteria for thinking about the development of a nosocomial infection are: the appearance of clinical signs of the disease no earlier than 48 hours after admission to the hospital; connection with invasive intervention; establishing the source of infection and transmission factor. The final judgment on the nature of the infectious process is obtained after identifying the pathogen strain using laboratory diagnostic methods.
To exclude or confirm bacteremia, bacteriological blood cultures are performed for sterility, preferably at least 2-3 times. In localized forms of nosocomial infection, microbiological isolation of the pathogen can be carried out from other biological environments, and therefore culture of urine, feces, sputum, wound discharge, material from the pharynx, swab from the conjunctiva, and from the genital tract is performed for microflora. In addition to the cultural method for identifying pathogens of nosocomial infections, microscopy, serological tests (RSC, RA, ELISA, RIA), virological, molecular biological (PCR) methods are used.
Treatment of nosocomial infections
The difficulties of treating nosocomial infections are due to its development in a weakened body, against the background of the underlying pathology, as well as the resistance of hospital strains to traditional pharmacotherapy. Patients with diagnosed infectious processes are subject to isolation; The department undergoes thorough ongoing and final disinfection. The choice of antimicrobial drug is based on the characteristics of the antibiogram: for nosocomial infections caused by gram-positive flora, vancomycin is most effective; gram-negative microorganisms – carbapenems, IV generation cephalosporins, aminoglycosides. Additional use of specific bacteriophages, immunostimulants, interferon, leukocyte mass, and vitamin therapy is possible.
If necessary, percutaneous blood irradiation (ILBI, UVB), extracorporeal hemocorrection (hemosorption, lymphosorption) are performed. Symptomatic therapy is carried out taking into account the clinical form of nosocomial infection with the participation of specialists of the relevant profile: surgeons, traumatologists, pulmonologists, urologists, gynecologists, etc.
Prevention of nosocomial infections
The main measures to prevent nosocomial infections come down to compliance with sanitary, hygienic and anti-epidemic requirements. First of all, this concerns the disinfection regime of premises and care items, the use of modern highly effective antiseptics, high-quality pre-sterilization treatment and sterilization of instruments, strict adherence to the rules of asepsis and antiseptics.
Medical personnel must observe personal protective measures when performing invasive procedures: work in rubber gloves, goggles and a mask; handle medical instruments carefully. Vaccination of health workers against hepatitis B, rubella, influenza, diphtheria, tetanus and other infections is of great importance in the prevention of nosocomial infections. All health care facility employees are subject to regular scheduled dispensary examinations aimed at identifying the carriage of pathogens. To prevent the occurrence and spread of nosocomial infections will be possible by reducing the length of hospitalization of patients, rational antibiotic therapy, the validity of invasive diagnostic and therapeutic procedures, and epidemiological control in health care facilities.
1Despite the search and implementation of new methods to combat hospital microbes, nosocomial infections are a current topic of research due to the constant change in the properties of the microflora. A sanitary and bacteriological study revealed hospital strains: Proteus spp., Staphylococcus aureus, Acinetobacter spp., Streptococcus spp., Klebsiella pneumoniae, Enterobacter and molds. Since the most frequently encountered strains were Staphylococcus aureus strains, the characteristics of Staphylococcus aureus were investigated. The isolated strains of Staphylococcus aureus had a high persistent potential, multiple resistance to antibiotics and some disinfectants, which allowed the pathogenic microflora to remain in the environment for a long time and resist the protective forces of the macroorganism. The high persistent potential of isolated staphylococcal strains is a risk factor for patients, leading to the development of protracted purulent-inflammatory diseases.
nosocomial infections
Staphylococcus aureus
persistence factors
antibiotic resistance
1. Akimkin V.G., Klyuzhev V.M. Nosocomial infections: meaning, definition, causes, structure, main anti-epidemic measures // Epidemiologist.ru: website - URL: http://www.epidemiolog.ru/publications/detail.phpID=824.
2. Bukharin O.V., Usvyatsov B.Ya.. Bacterial carriage (methodological and environmental aspect). – Ekaterinburg: Ural Branch of the Russian Academy of Sciences, 1996. – 207 p.
3. Bukharin O.V., Usvyatsov B.Ya., Malyshkin A.P., Nemtseva N.V. Method for determining antilysozyme activity of microorganisms // Journal. microbiol. epidemiol. and immunobiol. – 1984. – N 2. – P. 27–28.
4. Bukharin O.V., Fadeev S.B., Isaychev B.A. Dynamics of species composition, antilysozyme activity and antibiotic resistance of pathogens of surgical infections of soft tissues // Journal. microbiol., epidemiol. and immunobiol. – 1997. – No. 4. – P. 51–54.
5. Vereshchagina S.A. Nosocomial infections in a multidisciplinary surgical hospital: dis. ...cand. honey. Sci. – Irkutsk, 2005. – 112 p.
6. Nosocomial infection / Scherertz, Hampton, Ristucina / ed. R.P. Wenzela. – M.: Medicine 1990.
7. Deryabin D.G., Kurlaev P.P., Brudastov Yu.A. The role of persistent characteristics in determining the protracted course of a purulent-inflammatory process // Journal. microbiol., epidemiol. and immunobiol. – 1996. – N 3. – P. 74–77.
8. Zheltova V.I., Shulga I.A., Safronov A.A. Antilysozyme activity and biological properties of staphylococci in purulent-septic diseases // Persistence of microorganisms / ed. O.V. Bukharin. – Kuibyshev, 1987. – P. 19–22.
9. Zykova L.S. Factors of persistence of uropathogens in the diagnosis, prognosis and treatment of pyelonephritis in children: abstract. dis. ...Dr. med. Sci. – Orenburg, 1998. – 35 p.
10. Kulaev I.S., Severin A.I., Abramochkin G.V. Bacteriological enzymes of microbial origin in biology and medicine // Bulletin of the USSR Academy of Medical Sciences. – 1984. – No. 8. – P. 64–69.
11. Parshuta A.I., Usvyatsov B.Ya. The role of persistence factors in the formation of microbial biocenosis of the nasal mucosa in staphylococcal bacteria carriers // JMEI. –1998. – No. 1. – P. 18–21.
12. Sanitary rules for the design, equipment and operation of hospitals, maternity hospitals and other medical hospitals No. 5179-90 dated June 29, 1990.
13. Kharaeva Z.F. Factors of persistence of pathogens of nosocomial infections: guidelines. - Nalchik. KBSU, 2010. – 55 p.
Despite the search and implementation of new methods of combating hospital microbes, the problem of nosocomial infections remains one of the most acute in modern conditions, acquiring increasing medical and social significance. The relevance of the problem of nosocomial infections is due to the emergence of so-called hospital-acquired (usually multiresistant to antibiotics and chemotherapy) strains of staphylococci, salmonella, Pseudomonas aeruginosa and other pathogens. They spread easily among children and the weakened, especially the elderly, patients with reduced immunological reactivity, who constitute the so-called risk group.
The incidence of hospital infections ranges from 5 to 20% of the total number of patients hospitalized in medical institutions. According to the results of a number of studies, the mortality rate in the group of hospitalized patients who acquired nosocomial infections is 8-10 times higher than that among hospitalized patients without nosocomial infections. Pathogens of hospital infections are characterized by high persistent potential and rapidly developing resistance to disinfectants and antibiotics, which allows pathogenic microflora to remain in the environment for a long time and resist the defenses of the macroorganism.
Nosocomial infections are mostly caused by bacterial origin. Viral, fungal pathogens and protozoa are much less common. A feature of nosocomial infections is that they can be caused not only by obligate (for example, M. tuberculosis), but also by opportunistic pathogens with relatively low pathogenicity (S. maltophilia, Acinetobacter spp., Aeromonas spp., etc.), especially in patients with immunodeficiencies. Despite the lower virulence of opportunistic microorganisms compared to the “classical” pathogens of nosocomial infections (S. aureus, P. aeruginosa, E. coli, Klebsiella spp.), their etiological importance has increased significantly in recent years.
The main causative agents of bacterial infections are staphylococci, pneumococci, gram-negative enterobacteria, pseudomonas and representatives of strict anaerobes. The dominant role is played by staphylococci (up to 60% of all cases of nosocomial infections), gram-negative bacteria, respiratory viruses and fungi of the genus Candida. Bacterial strains isolated from patients with nosocomial infections tend to be more virulent and have multiple chemoresistance.
In this regard, the purpose of this study was to identify the main features of nosocomial Staphylococcus aureus strains of nosocomial infections, including persistence potential, antibiotic resistance and sensitivity of hospital strains to disinfectants.
The most general qualitative definition characterizing the ability of a microorganism to interact with a susceptible macroorganism with the development of an infectious process is pathogenicity. The concept of “virulence” is traditionally used as a quantitative measure of pathogenicity, reflecting the intensity of the altering effect of the infection on the host organism. In the clinic, the criteria for the virulence of microorganisms are the severity of infectious processes and the intensity of individual symptoms and syndromes, which depends on the set of toxins, enzymes, adhesive and invasive properties of bacteria. Another side of the pathogenicity of microorganisms is the ability not only to initiate the development of an infectious process, but also to maintain it for a relatively long period of time (persistence).
Materials and research methods
A bacteriological study of microbial contamination of environmental objects was carried out in accordance with methodological recommendations for the sanitary and epidemiological regime. Sampling from the surfaces of various objects was carried out using the swab method. Strains were identified taking into account their morphological and cultural characteristics. Antilysozyme, anticomplementary, and catalase activities have been studied as persistence factors. Antibiotic sensitivity was studied using the disk diffusion method. The sensitivity of the isolated strains to a 0.01% anolyte solution was studied by adding an appropriate dilution to a liquid bacterial culture. Statistical processing was carried out using standard methods.
Research results and discussion
When studying swabs in a medical institution, Staphylococcus aureus strains were isolated in 35% of cases, Klebsiella pneumoniae strains were isolated in 17% of samples, Proteus vulgaris and Proteus mirabilis in 10%, Enterobacter and Acinetobacter in 2-5%. Since the most frequently encountered strains were Staphylococcus aureus strains, the characteristics of Staphylococcus aureus were investigated.
Antilysozyme (ALA), antiinterferon (AIA), and anticomplementary (ACA) activities were studied as persistence factors as possible ways to counter the oxygen-independent mechanism of phagocytosis and the activity of the antioxidant bacterial enzyme catalase. 67% (20 cultures) of the 30 studied strains had antilysozyme activity. 44% (13 cultures) had AIA, 34% (10 cultures) of the S. aureus strains we studied had AKA.
It is known that the primary bactericidal factors secreted by phagocytes are hydrogen peroxide and the products of its free radical decomposition, such as hypochloride and hydroxyl radical. Staphylococci adapt to survive in environments with elevated concentrations of hydrogen peroxide by inducing early response genes to oxidative damage. The protein products of these genes are, among others, the enzyme catalase, which decomposes hydrogen peroxide into neutral products - water and molecular oxygen, and the enzyme superoxide dismutase, which decomposes the superoxide anion radical into molecular oxygen. Catalase activity was detected in 80% of the strains; when quantitatively assessing the catalase activity of bacteria, it was found that most of the strains (55%) had high enzyme activity (4.0-5.1 units/20 million).
35-42% of S. aureus strains had multiple resistance, while exhibiting sensitivity to cephalosporin drugs (ceftriaxone, cefotaxime, cefuroxime). To study sensitivity to disinfectants used in medical institutions, a series of experiments was carried out to determine the sensitivity of S. aureus to an anolyte solution. It was found that the isolated strains showed resistance in more than 60% of cases to a 0.01% anolyte solution.
Thus, when studying the main features of nosocomial infections, including persistent potential, antibiotic resistance and sensitivity of hospital strains to disinfectants, the following conclusions can be drawn:
1. When further selecting disinfectants in hospitals, it is necessary to take into account that the isolated strains showed resistance to the 0.01% anolyte solution used in modern medical institutions for disinfection. This disinfectant solution may need to be used in a higher concentration or replaced with another solution.
2. The high persistent potential of isolated staphylococcal strains is a risk factor for patients, leading to the development of protracted purulent-inflammatory diseases. Therefore, the study of pathogenetically significant properties of microorganisms aimed at inactivating the effectors of anti-infective immunity and thereby disrupting the process of eliminating the pathogen from the source of inflammation can become an alternative approach to predicting the duration of purulent-inflammatory diseases and makes it possible to timely use immunocorrective drugs.
Reviewers:
Borukaeva I.Kh., Doctor of Medical Sciences, Professor of the Department of Normal and Pathological Physiology of KBSU, Kabardino-Balkarian State University named after. HM. Berbekova", Nalchik;
Khasaeva F.M., Doctor of Biological Sciences, Professor of the Department of Veterinary and Sanitary Expertise, Kabardino-Balkarian State Agrarian University named after. V.M. Kokova", Nalchik.
The work was received by the editor on October 30, 2014.
Bibliographic link
Kharaeva Z.F., Balakhova B.O., Belimgotova R.R., Mustafaev I.M., Tugusheva D.S., Chochueva N.A., Shekikhacheva F.Yu. FEATURES OF HOSPITAL STRAINS OF STAPHYLOCOCCUS AUREUS // Fundamental Research. – 2014. – No. 11-6. – P. 1316-1318;URL: http://fundamental-research.ru/ru/article/view?id=35722 (access date: 12/13/2019). We bring to your attention magazines published by the publishing house "Academy of Natural Sciences"
Owners of patent RU 2404254:
The invention relates to the identification of hospital strains of microorganisms in medical institutions and the implementation of appropriate anti-epidemic measures in them. The method involves determining the genotypic characteristics of the virulence of the strains under study and comparing them with the genotypic characteristics of the virulence of strains isolated in a medical institution from patients and surrounding objects. Strains are classified as hospital strains if the genotypic characteristics of the virulence of the strains under study correspond to the genotypic characteristics of the virulence of at least one of the strains isolated in a medical institution from patients and surrounding objects. Using the method simplifies the identification of hospital strains and reduces the time for identifying hospital strains. 1 table
The invention relates to the field of medicine, namely to epidemiology, and can be used to detect the circulation of hospital strains and to carry out anti-epidemic measures in medical institutions.
The relevance of the problem of nosocomial infections is determined by their wide distribution in medical institutions of various profiles and the significant damage these diseases cause to public health.
To identify the circulation of hospital strains in microbiological practice, epidemiological marking methods are used, the essence of which is that isolated cultures are identified to genus and species, and then intraspecific identification is carried out in order to establish biovar, serovar, ecovar, resistance to antibacterial substances, and genotype. The proposed methods require significant material costs and a long time for laboratory research.
There is a known method for identifying hospital strains by determining the sensitivity of strains to antibiotics, compiling antibiograms and comparing antibiograms of bacterial cultures isolated from patients and from the environment.
The disadvantage of the proposed method is the lack of specificity due to the widespread prevalence of antibiotic resistance, including in non-hospital strains of pathogens, as well as the difficulty of interpreting the results due to the high degree of heterogeneity of the hospital population of the pathogen in terms of antibiotic resistance.
There is a known method for identifying hospital strains, which includes determining the biorhythms of bacteria isolated from patients and comparing the resulting biorhythms with the biorhythms of reference non-hospital strains of a given type of bacteria. Biorhythms are analyzed according to the period of bacterial reproductive activity, rhythm frequency, mesor, amplitude of bacterial reproductive activity and acrophase. If the biorhythms of the isolated bacterial strain do not coincide with the biorhythms of the reference non-hospital strain, the isolated strain is classified as hospital-acquired.
The disadvantages of this method include the difficulty of interpreting the results, low specificity due to the significant diversity of hospital and non-hospital genotypes with different biorhythms. In addition, when implementing this method, round-the-clock work of a microbiologist is required, taking measurements after 8, 12, and 24 hours from the start of the research.
As a prototype based on the closest technical essence, we have chosen a method for diagnosing a hospital strain of Pseudomonas aeruginosa aeruginosa, which includes determining the sensitivity of the strain to antibiotics, its phagotype and serotype, resistance to disinfectants, plasmid profile, adhesion coefficient to epithelial cells, the strain PSEUDOMONAS AERUGIOSA is diagnosed as hospitalized in the absence of sensitivity to nine or more antibiotics, the same phagoserotype, resistance to five disinfectants, a similar plasmid profile and an adhesion coefficient of 15±0.2 or more.
The disadvantages of the method adopted as a prototype include the fact that the method is labor-intensive and time-consuming, as it requires the determination of many characteristics of the strains under study; it takes 10-15 days to obtain the final result of the study. The implementation of the method also requires significant material costs.
The technical result of the invention is to simplify the method for identifying hospital strains and reduce the time it takes.
This technical result is achieved by determining the genotypic characteristics of the virulence of the strains under study and comparing them with the genotypic characteristics of the virulence of strains isolated in a medical institution from patients and surrounding objects. Strains are classified as hospital strains if the genotypic characteristics of the virulence of the strains under study correspond to the genotypic characteristics of the virulence of at least one of the strains isolated in a medical institution from patients and surrounding objects.
The proposed method is carried out as follows.
Species identification of the isolated culture is carried out, DNA is isolated and the presence of nucleotide sequences corresponding to gene regions of pathogenicity factors most typical for clinically significant isolates of a given species is determined by polymerase chain reaction or any other express method.
Based on the presence of certain genes, the genotypic characteristics of virulence or pathovars of the studied strains are determined and compared with the genotypic characteristics of virulence or pathovars of strains isolated in a medical institution from patients and surrounding objects and having a presumed epidemiological connection with the strains being studied. A strain is classified as a hospital strain if the genotypic characteristics of the virulence of the strains under study correspond to the genotypic characteristics of the virulence of at least one of the strains isolated from patients and surrounding objects in a medical institution.
Distinctive essential features of the proposed method are:
Determination of genotypic characteristics of virulence of the studied strains and their comparison with genotypic characteristics of virulence of strains isolated in a medical institution from patients and surrounding objects;
Classification of a strain as a hospital strain if the genotypic characteristics of the virulence of the studied strains correspond to the genotypic characteristics of the virulence of at least one of the strains isolated from patients and surrounding objects in a medical institution.
Cause-and-effect relationship between distinctive essential features and the achieved result
The choice of these genotypic characteristics as the main distinguishing features of the claimed invention is based on the theoretical position substantiated by the authors that virulence is the main characteristic of the hospital strain. For example, an increase in the level of virulence was noted during the formation of a hospital strain of Pseudomonas aeruginosa in a urological hospital, Serratia marcesens in the neonatal intensive care unit. However, other biological characteristics of hospital strains, such as antibiotic resistance, are secondary. It has been shown, in particular, that multiple resistance to antibacterial drugs can be equally characteristic of both hospital and non-hospital strains of enterococci. Thus, from our point of view, methods for identifying hospital strains based on the determination of antibiograms are not sufficiently specific and require mandatory confirmation using other intraspecific typing methods. At the same time, it is known that hospital populations of pathogens of nosocomial infections differ from non-hospital populations by containing a larger number of genes of pathogenicity factors that cause increased virulence. In this case, epidemiologically related cultures will have the same set of pathogenicity factors, representing one strain. This circumstance makes it possible to use the presence of genes for pathogenicity factors (at least one, since strains that do not have them have no clinical and epidemic significance) and their combination (i.e., genotypic characteristics of virulence) as a distinctive feature of a hospital strain, provided that other strains isolated in a medical institution have similar genotypic characteristics, i.e. there is evidence of their epidemiological connection.
Thus, the use of our proposed method allows us to quickly identify the main inherent properties of a hospital strain (virulence and the genetic determinants that determine it) and identify the hospital strain based on the presence of these properties.
The set of distinctive essential features is new and allows, unlike the prototype, to simplify the method of identifying hospital strains and reduce the time of its implementation.
Examples of using the method
During epidemiological observation in a gynecological hospital, the genetic characteristics of Enterococcus spp. strains were determined. according to the claimed method using polymerase chain reaction (PCR) for 5 virulence genes - gelE, sprE, fsrB, esp and asal. To isolate DNA, enterococcal strains were grown in tryptose soy broth (BioMerieux), after which DNA was isolated using express PCR.
PCR was carried out starting with preliminary incubation of samples at 94°C for 2 minutes, and then for 30 cycles under the following conditions: denaturation (94°C) - 30 sec, annealing (47°C-65°C, depending on G-C composition of primers) - 60 sec, synthesis (72°C) - 60 sec, final synthesis 10 min at 72°C. The primers given in the table were used for amplification. The experiment was performed on an MJ Research instrument.
PCR results were assessed after electrophoresis in 1% agarose gel under ultraviolet light.
During the epidemiological observation in the gynecological hospital, it was revealed that E. faecium No. 429 was isolated from patient L., who was admitted on July 9, 2005 with a diagnosis of metroendometritis (case history No. 25230), on the fifth day of her stay in the department. Based on the determination of virulence genes, this strain was classified as genotype 2 (presence of the esp gene in the absence of the gelE, sprE, fsrB, asal genes). On the same day, this pathogen of the corresponding genotype was isolated from glove washes (strain 138 vs). An epidemiological examination revealed that on July 11, 2005, during examination of patient L., strain No. 421, similar in genotypic characteristics to the above strains, was isolated from the posterior vaginal vault and cervical canal.
In this case, the transmission factor could have been gloves considered sterile, taken for examination from a common bag that had already been opened.
Thus, cultures No. 421, 429 and 138 bc had the same genotypic characteristics, the esp pathogenicity factor gene, and had an obvious epidemiological connection; Based on the above characteristics, they were classified as a hospital strain.
In the Department of Purulent Osteology, epidemiological surveillance of nosocomial infections caused by methicillin-resistant strains of Staphylococcus aureus (MRSA) was carried out. In October 2008, MRSA with genotype 1 (presence of the sea gene, in the absence of the seb, sec, pvl, tst genes) was identified in four hospital patients. Due to the fact that the epidemic spread of the hospital strain of MRSA in the hospital was assumed, it was decided to conduct a bacteriological examination of the hospital environment in order to identify factors for the transmission of this strain. As a result of this examination, 4 cultures of staphylococcus were isolated: 139 VS (from the washout from the handle of the dressing table), 140 VS (from the washout from the handle of the tap in the dressing room), 148 VS (from the hands of nurse A.N.), 1a (from air dressing). The inventive method was used to classify these cultures as a hospital strain. Determination of virulence genes (enterotoxins A, B, C, toxic shock gene and Panton-Vallentyne toxin gene) was carried out according to the method of M. Mehrortra and Lina G
As a result of the studies, cultures 139 vs. and 140 vs. were assigned to genotype 1 (presence of the sea gene, in the absence of the seb, sec, pvl, tst genes), culture 148 vs. was assigned to genotype 2 (presence of the sea, seb genes, in the absence of the genes sec, pvl, tst), and when studying culture 1a, it turned out that it does not contain the genes of pathogenicity factors under study. Thus, when comparing the genetic characteristics of the studied cultures with the genetic characteristics of strains previously detected in the hospital, cultures 139 vs. and 140 vs. were classified as a hospital strain, while cultures 148 vs. and 1a were not classified as hospital strains.
The inventive method was tested in organizing epidemiological surveillance of nosocomial infections in hospitals in St. Petersburg (gynecological department of the Mariinskaya Hospital, department of purulent osteology of the Peter the Great Hospital, hospital of the city center for the prevention of AIDS and infectious diseases). A total of 105 strains of enterococci and 61 strains of Staphylococcus aureus were studied. In the first two hospitals, testing of the proposed method made it possible to identify the formation of hospital strains of enterococci and Staphylococcus aureus. Due to the fact that the traditionally used method of classifying cultures as a hospital strain, based on determining the antibiogram, has insufficient specificity, the epidemiological marking method was used to verify the correctness of classifying the studied cultures as a hospital strain. To determine whether the isolated cultures belong to one strain (clonal type), a combination of several intraspecific typing methods, which are independent of each other, was used (phagotype and antibiogram for enterococci, typing by pulsed-field DNA electrophoresis, spa-sequencestip and antibiogram for staphylococci), and surveillance was used to prove that the strain caused associated hospital cases. The use of a combination of intraspecific typing methods in comparison with epidemiological data allows for reliable identification of the hospital strain. A total of 38 microbial cultures were tested using the proposed method and comparison method. In all cases, the use of this methodological technique made it possible to confirm the correctness of classifying the studied cultures as a hospital strain.
Thus, the proposed method makes it possible to identify hospital strains.
In contrast to the method chosen as a prototype, the inventive method for identifying hospital strains can significantly reduce the time spent on identifying a hospital strain.
According to our observations, the time required to identify 5 genes of pathogenicity factors in 10 bacterial strains ranges from 7 to 12 hours (from the moment of obtaining a pure culture of the microorganism), thus, the process of classifying the studied strain as a hospital strain is no more than two working days, in contrast to 10 -15 days when identifying a hospital strain using the method chosen as a prototype.
To perform this method, unlike the prototype, does not require highly qualified medical personnel, which requires mastery of complex molecular genetic (isolation and restriction of plasmids) and microbiological (determining the adhesion of a microorganism to the epithelium) techniques. In addition, the process of identifying genes using the PCR method, in contrast to the characteristics determined by the method chosen as a prototype, can be partially or fully automated using robotics, which significantly reduces time and labor costs.
The features of the proposed method also include the ease of interpretation of the results, since the classification of the studied culture as a hospital strain is made on the basis of only one criterion - the correspondence of the genotypic characteristics of the virulence of the studied strain with the genotypic characteristics of the virulence of at least one of the strains isolated from patients and surrounding objects in treatment and prophylactic institution.
Thus, the inventive method makes it possible to simplify the identification of hospital strains and reduce the time of the method.
Literature
1. Semina N.A. Nosocomial infections as a biosafety problem. /N.A.Semina. //Bulletin of the Russian Academy of Medical Sciences. - 2002. - No. 10. - P.48-50.
2. Zueva L.P., Yafaev R.Kh. Epidemiology: Textbook. - St. Petersburg, 2006. - 752 p.
3. Pfaller M.A., Cormican M.J. Microbiological aspects of the problem of nosocomial infections: the role of the clinical laboratory. In the book. R.P. Wenzel. Nosocomial infections. M. 2004. - 840 p.
4. RU 2245922, 02/10/2005.
5. RU 2285258, 10.10.2006.
6. RU 2110579, 05/10/1998.
7. Yafaev R.Kh., Zueva L.P. Epidemiology of nosocomial infection. L.: Medicine, 1989. - 168 p.
8. Lyubimova A.V., Zueva L.P., Eremin S.R., Khrustaleva N.M., Lyubimenko V.A., Pulin A.M., Shulaeva S.V., Leshchinskaya V.N. Progress in implementing an infection control system in neonatal intensive care units. In the book: L.P. Zueva. Experience in implementing infection control in health care institutions. St. Petersburg 2003, pp.91-129.
9. Yafaev R.Kh., Kolodzhieva V.V., Ermolenko E.I., Suvorov A.N. Enterococcal infections of the urogenital tract in hospital and clinic settings. Hospital-replacing technologies. Outpatient surgery. No. 3 (23), 2006
10. Becker, K., A. W. Friedrich, G. Lubritz, M. Weilert, G. Peters, and C. von Eiff. 2003. Prevalence of genes encoding pyrogenic toxin superantigens and exfoliative toxins among strains of Staphylococcus aureus isolated from blood and nasal specimens. J. Clin. Microbiol. 41:1434–1439.
11. Schmidt, H. and Hensel, M. (2004) Pathogenicity islands in bacterial pathogenesis. Clin. Microbiol. Rev., 17, 14-56. 12, 656-664.
12. Mehrotra M., Wang G. and Johnson W.M. Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxins, exfoliative toxins, toxic shock syndrome toxin 1, and methicillin resistance. // J. Clin. Microbiol. - 2000, 38, 3: 1032-1035.
13. Lina G., Piemont Y., et al. Involvement of Panton-Valentine leukocidin-producing Staphylococcus aureus in primary skin infections and pneumonia. Clin Infect Dis 1999; 29:1128-1132.
14. Shaginyan I.A. The role and place of molecular genetic methods in the epidemiological analysis of nosocomial infections. Wedge. microbiology and antimicrobial chemotherapy." 2000. - T2, No. 3, pp. 82-95.
| Genes and primers | Nucleotide sequence 5′-3′ | Expected size of amplification product n.p. | |
| gelE | gelE 1 | ACCCCGTATCATTGGTTT | 419 |
| gelE 2 | ACGCATTGCTTTTCCATC | ||
| esp | esp 1 | TTGCTAATGCTAGTCCACGACC | 933 |
| esp 2 | GCGTCAACACTTGCATTGCCGAA | ||
| sprE | spr 1 | GCGTCAATCGGAAGAATCAT | 233 |
| spr 2 | CGGGGAAAAAGCTACATCAA | ||
| fsrB | fsr 1 | TTTATTGGTATGCGCCACAA | 316 |
| fsr 2 | TCATCAGACCTTGGATGACG | ||
| asal | asa 1 | CCAGCCAACTATGGCGGAATC | 529 |
| asa 2 | CCTGTCGCAAGATCGACTGTA |
A method for identifying hospital strains, including determining the genotype of the strain, characterized in that the genotypic characteristics of the virulence of the studied strains are determined and compared with the genotypic characteristics of the virulence of strains isolated in a medical institution, from patients and surrounding objects, the strains are classified as hospital strains if the genotypic characteristics correspond virulence of the studied strains; genotypic characteristics of the virulence of at least one of the strains isolated in a medical institution, from patients and surrounding objects.
Formation of hospital strains. The term hospital strain of microbe is widely used in the literature, but there is no common understanding of this concept. Some believe that a hospital strain is one that is isolated from patients, regardless of its properties.
Most often, hospital strains mean cultures that are isolated from patients in a hospital and are characterized by pronounced resistance to a certain number of antibiotics, i.e., according to this understanding, a hospital strain is the result of the selective action of antibiotics. It is precisely this understanding that is included in the first definition of hospital strains available in the literature, given by V.D. Belyakov and co-authors.
Bacterial strains isolated from patients with nosocomial infections are usually more virulent and have multiple chemoresistance. The widespread use of antibiotics for therapeutic and prophylactic purposes only partially suppresses the growth of resistant bacteria and leads to the selection of resistant strains. A vicious circle is formed - emerging nosocomial infections require the use of highly active antibiotics, which in turn contribute to the emergence of more resistant microorganisms. An equally important factor should be considered the development of dysbiosis that occurs during antibiotic therapy and leads to the colonization of organs and tissues by opportunistic microorganisms Tab. 1. Factors predisposing to the development of infections.
External factors are specific to any hospital Microflora of the patient Invasive medical procedures performed in the hospital Medical personnel Equipment and instruments Skin Long-term catheterization of veins and bladder Constant carriage of pathogenic microorganisms Food products Gastrointestinal tract Intubation Temporary carriage of pathogenic microorganisms Air Genitourinary system Surgical violation of the integrity of anatomical barriers Sick or infected employees Le medicinal agentRespiratory tractEndoscopyTable 2. The main causative agents of nosocomial infections Bacteria Viruses Protozoa Fungi Staphylococcus and HBV, HCV, HDV Pneumocystis Candida Streptococci HIV Aspirgillus Pseudomonas aeruginosa Influenza viruses and other acute respiratory viral infections Cryptosporidium Etorobacteria Measles virus Escherichia Rubella virus Salmonella Epidemiological mumps virus itaShigella Yersinia Rotavirus Mystery Cambilobacteria Enterobacteria Legionella Herpes virus Clostridia Cytomegalovirus Non-spore-forming anaerobic bacteria Mycoplasma Chlomydia Mycobacteria Bordetella Tab. 3. Main sources of hospital infections SourceRole of the source in the spreadPatientsThe main source role in the spread varies for different nosological forms and in different hospitalsCarriersIs of great importance in the spread of staphylococcal infections, hepatitis B, C and D, salmonellosis, shigellosis, etc. Medical workersMore often asymptomatic carriers of predominantly hospital strains play an important role role in the spread of pathogens of respiratory infections pneumocytosis, pneumonia, bronchitis and ARVI. The frequency of carriage can reach 50. Persons involved in caring for patients are not of great importance; they can be carriers of streptococci, staphylococci, entero- and cambilobacteria, causative agents of sexually transmitted diseases, rotaviruses, cytomegaloviruses and other herpetoviruses, causative agents of hepatitis and diphtheria, pneumocystis. Visitors visiting patients The role is very limited; I may be carriers of staphylococci, enterobacteria, or suffer from acute respiratory viral infections. Table 4. Transmission of infection to and from hospital staff Diseases Route of transmission From patient to medical personnel From medical personnel to patient AIDS Chickenpox disseminated herpes zoster High High Localized herpes zoster Low Low Viral conjunctivitis High High Cytomegalovirus infection Low Hepatitis AN Low Rare Hepatitis VL LowRareHepatitis Neither A nor BLow-Herpes SimplexLowRare InfluenzaModerateModerateMeaslesHighHigh Meningococcal infectionRare-MumpsModerateModerateWhooping coughModerate ModerateRespiratory syncytial virusModerateModerateRotavirusModerateModerateRubellaModerateModerateSalm onellaShigellaLowLowScabiesLowLowS. aureus-RarelyStreptococcus, group A-RarelySyphilisLow-TuberculosisFrom low to highFrom low to high 3 Objects, materials and methods of research Objects of research during bacteriological control are - air - various environmental objects - surgical instruments - syringes, needles - multiple blood transfusion systems use of probes, catheters, bougies, rubber gloves and other products made of rubber and plastic compounds - surgical suture material prepared for use - surgeons' hands and the skin of the surgical field. The study of sanitary and hygienic conditions includes determining the air temperature in the main rooms of the hospital wards, treatment rooms, dressing rooms, operating rooms and other rooms using mercury and alcohol thermometers, relative humidity is measured using an Assmann psychrometer, air speed with a ball catheterometer, illumination with a Yu-16 luximeter. Measurements are carried out using generally accepted methods in accordance with modern regulatory documents.
The concept of microbiological control of a hospital includes bacteriological examination of environmental objects for the presence of pathogenic microorganisms that can cause nosocomial infections.
Planned bacteriological control is based on the determination of general microbial contamination and the identification of sanitary-indicative microorganisms: staphylococci, Escherichia coli bacteria, etc. When conducting bacteriological studies, the set of premises in which sampling is carried out and the list of environmental items subject to examination are determined in accordance with the order Ministry of Health of the USSR 720 dated July 31, 1978 3.1
End of work -
This topic belongs to the section:
Sanitary microbiological research and monitoring of nosocomial infections in medical institutions
Joining the main disease, V. and. worsens the course and prognosis of the disease. Problems of V. and. have acquired great relevance in connection with the emergence of so.. They easily spread among children and the weakened, especially the elderly, patients with reduced immunological..
If you need additional material on this topic, or you did not find what you were looking for, we recommend using the search in our database of works:
What will we do with the received material:
If this material was useful to you, you can save it to your page on social networks:
Hospital strain - an unknown reality
N.I. Briko1 ( [email protected]), E.B. Brusina2, 3 ( [email protected]), L.P. Zueva4, O.V. Kovalishena5, L.A. Ryapis1, V.L. Stasenko6, I.V. Feldblyum7, V.V. Shkarin5
1GBOU VPO "First Moscow State Medical University named after. THEM. Sechenov" of the Ministry of Health of Russia
2GBOU VPO "Kemerovo State Medical Academy" of the Ministry of Health of Russia
3FGBU "Research Institute of Complex Problems of Cardiovascular Diseases" of the Siberian Branch of the Russian Academy of Medical Sciences, Kemerovo 4GBOU HPE "North-Western Medical University named after. I.I. Mechnikov" of the Ministry of Health of Russia, St. Petersburg
5GBOU VPO "Nizhny Novgorod State Medical Academy" of the Ministry of Health of Russia
6 State Budgetary Educational Institution of Higher Professional Education “Omsk State Medical Academy” of the Ministry of Health of Russia 7 State Budgetary Educational Institution of Higher Professional Education “Perm State Medical Academy named after. acad. E.A. Wagner" of the Ministry of Health of Russia
The article discusses modern ideas about the hospital strain and controversial aspects of this problem. A standard definition of a hospital strain (clone) is given. The hospital strain is determined based on a set of necessary and additional criteria. The set of necessary criteria includes: 1) identity and homogeneity of the characteristics of the isolated pathogen according to the pheno- and genotypic characteristics of the population of microorganisms; 2) circulation of this pathogen among patients. Additional criteria that are significantly more common among hospital clones (strains) may include the presence of genes or virulence factors, antibiotic resistance, resistance to disinfectants and antiseptics, resistance in the external environment, increased adhesiveness and other variable characteristics. Key words: healthcare associated infections, hospital strain, standard definition
Hospital Strain - Mysterious Reality
N.I. Briko1 ( [email protected]), E.B. Brusina2,3 ( [email protected]), L.P. Zueva4, O.V. Kovalishena5, L.A. Ryapis1, V.L. Stasenko6, I.V. Fel"dblum7, V.V. Shkarin5
1I.M. Sechenov First Moscow State Medical University, State Budget Educational Institution of Higher Professional Training Ministry of Healthcare of the Russian Federation
2 Kemerovo State Medical Academy, State Budget Educational Institution of Higher Professional Training Ministry of Healthcare of the Russian Federation
3Research Institute for Complex Issues of Cardiovascular Diseases under the Siberian Branch of the Russian Academy of Medical Sciences, Kemerovo
4The Northwest State Medical University named after I.I. Mechnikov, State Budget Educational Institution of Higher Professional Training Ministry of Healthcare of the Russian Federation, St. Petersburg
5Nizhny Novgorod State Medical Academy, State Budget Educational Institution of Higher Professional Training Ministry of Healthcare of the Russian Federation
6 Omsk State Medical Academy, State Budget Educational Institution of Higher Professional Training of the Ministry of Healthcare of the Russian Federation
7Perm State Medical Academy named after E.A. Wagner, State Budget Educational Institution of Higher Professional Training Ministry
of Healthcare of the Russian Federation
The paper discusses the modern understanding of hospital strain and controversial aspects of the problem. Standard definition of the hospital strain (clone) is given. Hospital strain is defined on the basis of the complex of necessary and additional criteria. The complex of necessary criteria includes the following: 1) the identity of characteristics of isolated etiological agent to the properties of the microorganism"s population homogeneous on the pheno- and genotyping features; 2) presence of the circulation of this etiological agent among patients. Additional criteria, reliably more often occurring among hospital strains (clones), may include the presence of the genes or factors of virulence, antibiotic resistance, resistance to the disinfectants and antiseptics, resistance in the environment, the increased adhesion and other variable properties.
Key words: health-care associated infections, hospital strain, standard definition
One of the most confusing issues in the epidemiology of healthcare-associated infections (HAIs) is the concept of a hospital strain, the patterns of its formation and detection.
This article is problematic in nature and should be considered within the framework of the development of the provisions of the “National Concept for the Prevention of Infections Associated with the Provision of Medical Care”, and aims to raise controversial issues, as well as present for discussion the quintessence of modern ideas about the hospital strain. It is important to clarify that all the discussions below relate primarily to bacteria.
The share of infections caused by hospital strains in the overall structure of HAIs reaches 60%. It is this type of development of the epidemic process that leads to outbreaks and is characterized by high morbidity, severe infections and high mortality.
At the same time, an analysis of studies of the last decade indicates a lack of a consensus position regarding infections caused by hospital strains among specialists and a wide range of differences in ideas about the essence of this phenomenon. The complexity of this problem is also confirmed by the fact that until now there is no single definition of the concept of “hospital strain”, and this term itself is not accurate. In addition to the term “hospital strain”, terms such as “variant”, “ecovar”, “clone”, in combination with the definitions “hospital”, “nosocomial”, “hospital” are also widely used.
The starting point for understanding the outlined range of issues is terminology. If you follow the definition, then a “strain” (English strain, German Stamm - “tribe”, “genus”) is understood as “a pure culture of microorganisms of a given species, isolated from a specific source (the body of a sick animal or person, soil, water, etc. .p.) and having special physiological and biochemical properties.” The concept of “strain” relates to a greater extent to laboratory practice and denotes a collection of individuals of a certain type of microorganism, the common origin of which has not been established, grouped mainly by phenotypic characteristics.
The term “hospital variant of the pathogen” is also inaccurate, since the word “variant” reflects the state of variability of microorganisms and, therefore, does not imply the completion of the process of formation of the pathogen with fixed characteristics.
The term “ecovar” is defined as “a variant of a species, including a microorganism, adapted to inhabit a certain ecosystem, for example, a host species, a hospital setting. Often differs in a number of characteristics
from populations living in other ecosystems." This term, like the term “variant,” does not provide an idea of the biological essence of the new properties of the microorganism and does not reflect the typical characteristics acquired by the pathogen in a hospital environment. It should be applied to a greater extent when natural ecosystems are considered, despite the view that the hospital environment can be defined as a special case of an artificial ecosystem.
From an epidemiological point of view, it is more logical to consider the etiological agents that cause HAIs as a certain set of microorganisms that have adapted to hospital conditions, the composition of which we judge from individual isolates (strains). In this case, the definition of “hospital clone” is more accurate at the present stage. In the terminology of population genetics, “clone” (Greek clone - “branch”, “offspring”) is “a group of genetically identical or almost identical cells that in the recent past descended from a common ancestor and did not undergo chromosomal recombination.”
However, the phrase “hospital clone” can only be used if the single origin of the strains included in it has been proven. It should be borne in mind that in the conditions of an artificial hospital ecosystem during epidemic morbidity, even from sick people, strains are isolated that differ in molecular biological characteristics. As a rule, a dominant clone and several minor clones are identified, and the isolates included in them, depending on the typing method, are given an identification designation (emm type, sequence type, etc.).
In addition to terminological aspects, the issue of distinguishing hospital microorganisms from non-hospital ones is also important, since the very fact of isolating a pathogen from a hospitalized patient is not yet a basis for classifying this pathogen as hospital-acquired. Finally, it is important to know what properties (or what combination of them) are inherent in hospital strains, which would make it possible to confidently distinguish the latter from non-hospital cultures.
Studies from previous years indicate that, as a rule, typical characteristics of a hospital clone (strain) include resistance to antimicrobial drugs (antibiotics, disinfectants, antiseptics, etc.), increased virulence, resistance in the external environment, the ability to circulate for a long time in hospital conditions, increased colonization and adhesive properties, competitive activity and genetic uniformity.
In one of the many definitions, the phrase “hospital strain” means “a microorganism isolated from a patient or a medical worker in a hospital (outpatient), characterized by a pronounced
resistance to many antibiotics and disinfectants." However, all strains that have these properties isolated in a medical organization cannot be considered hospital strains.
Nevertheless, antibiotic resistance as a criterion for a strain to belong to a hospital strain is most often positioned. It is necessary to distinguish between resistance to antibiotics of a certain strain of a microorganism and the prevalence of resistance to antibiotics among microorganisms of a certain type in a medical organization, calculated as the ratio of the number of resistant cultures to the total number of studied cultures of one type of microorganism, reduced to a certain coefficient (100, 1000, etc.). Numerous studies over a 70-year period have shown that the prevalence of antibiotic resistance is higher among microorganisms isolated in a medical organization compared to community-acquired pathogens. The causative factors of this pattern were studied, the highest prevalence of antibiotic resistance in the microflora of intensive care units was demonstrated, and features of the territorial distribution and dynamic changes in time and space of resistance to individual drugs and in certain types of microorganisms, for example, methicillin-resistant staphylococci (MRSA) were identified. , vancomycin-resistant staphylococci and enterococci (VRS, VRE), etc.
However, markers of antibiotic resistance are not always detected in hospital strains. Numerous epidemic situations associated with the provision of medical care caused by antibiotic-sensitive strains have been described. Thus, out of 32 outbreaks caused by S. aureus, 12 were caused by multidrug-resistant strains, 11 were resistant to one or two antibiotics, and 9 were sensitive to all drugs routinely used for testing.
When determining whether different strains of a microorganism belong to the category of hospital strain, researchers are much more interested in the identity of the antibiogram (resistance type, resistance profile) of different cultures than in the presence of multiresistance. However, one should remember the variability of this trait.
To summarize the discussion about antibiotic resistance, it should be noted that although resistance to antibiotics, including polyantibiotic resistance, is more widespread among bacteria circulating in the hospital environment, it is not a mandatory characteristic of the hospital clone (strain) and cannot be used as the main one. criterion for its determination.
A similar situation arises with regard to the resistance of microorganisms to disinfectants and antiseptics. These antimicrobial agents
agents, widely used in medical organizations, are also an important selective factor for microflora. A number of studies have proven that the presence of resistance to disinfectants in a clone (strain) of a microorganism has consequences in the form of preferential circulation and an etiological role in epidemic morbidity. It is in cases of group morbidity and prolonged epidemic trouble that a higher prevalence of bacteria resistant to the disinfectants used is observed. At the same time, in these same studies and in a number of others, it was demonstrated that resistance to disinfectants and antiseptics is not a necessary condition for their occurrence and epidemic spread; moreover, this characteristic (property) cannot be considered as a mandatory independent marker of a hospital strain, since has pronounced heterogeneity.
Another important characteristic of microorganisms isolated in hospital conditions is their virulence. A large number of studies have been devoted to this problem. Works by L.P. Zueva and her colleagues convincingly showed that hospital strains leading to the development of epidemic situations have certain virulence genes. Of the 11 outbreaks studied by the authors, 10 were caused by pathogens that have virulence genes. But virulence as a sign of a hospital clone (strain) is also not a sufficient characteristic. The formation of a hospital clone is based on adaptation to the conditions of the hospital environment. During the process of adaptation, the pathogen gradually colonizes patients and personnel, contaminates environmental objects and persists on them for a long time, however, it can manifest itself for a certain time mainly as carriage. In the case when a hospital microorganism acquires certain virulence genes, the epidemic process manifests itself in manifest forms of infection with a severe course and high morbidity. Determining genes or virulence factors during the monitoring process is extremely important for predicting the upcoming epidemic situation and timely implementation of anti-epidemic measures.
One of the most important epidemiological criteria for a hospital strain is that it belongs to a population of circulating microorganisms that is homogeneous in composition. But phenotypic or molecular genetic identity does not always indicate the formation of a hospital clone. For example, in the event of an outbreak of infection as a result of the use of a contaminated medicinal product outside a medical organization (in production)
It is likely that genetically homogeneous strains are isolated from patients. In this case, the genetic identity of the strains only indicates a common exogenous source or transmission factor of the infectious agent.
The formation of a hospital clone (strain), as a rule, is the result of adaptation of a certain microorganism to specific hospital conditions, during which it acquires properties that significantly increase its competitive advantages in the struggle for habitat niches and food sources. The nature of the acquired properties is determined by intermicrobial interactions, characteristics of the patient population, medical personnel, a set of preventive and anti-epidemic measures and can vary significantly. In medical organizations, conditions are created that promote the selection of pathogens most adapted to a specific environment, which ultimately leads to intraspecific homogenization of the pathogen and its clonal distribution.
That is why it is not so much these or those characteristics or their combination that are important, but the degree of homogeneity of the microorganism population, which is expressed by the diversity coefficient (1 - the ratio of the number of microorganisms of a given species (resistance type) to the total number of species (resistance types) of microorganisms). It has been established that the diversity coefficient (diversity of species, resistance types, etc.) of less than 0.4 indicates a formed hospital strain.
However, despite the fact that adaptation and selection of microorganisms most adapted to the environment is the prevailing way of forming a hospital clone, there are other mechanisms. For example, a microorganism can instantly acquire a competitive advantage due to a chromosome deletion and, in a very short period of time, colonize components of a hospital community, causing an outbreak of infection. The possibility of such a development of events should be taken into account when investigating the epidemic situation. But even with this mechanism, there will be a decrease in the diversity of microflora.
In general, we note that the hospital environment is a complex, dynamic, “pulsating” artificial ecological system, which requires a continuous and adequate assessment of its condition. Determining whether a pathogen belongs to the hospital category can be based only on the results of monitoring circulating microflora during epidemiological diagnosis.
Optimal information parameters that reflect the state of the microbial population of the hospital environment and allow proactive (before the occurrence of disease cases) intervention in the epidemic process:
The presence of a dominant type of microorganism, expressed by a higher frequency of isolation and a higher specific gravity in the structure of the microbial population; coefficient of species diversity of microorganisms;
Diversity coefficient of resistance types (serotypes, biovars, plasmidovars, etc.) of a microorganism species;
The coefficient of diversity of genotypes (determined on the basis of molecular biological (genetic) methods of intraspecific typing of microorganisms (emm type, restricto type, sequence type, etc.).
The basis for intervention in the course of the epidemic process is a stable trend towards a decrease in the species and intraspecific (phenotypic, genetic) diversity of microorganisms circulating in hospital conditions. It should be especially noted that the very fact of isolating microorganisms from the hospital environment and from medical personnel is not an indicator of a true epidemic situation. The most important are cultures isolated from patients.
It should be taken into account that the phenomenon we are considering relates to the population level. When we talk about a hospital clone (strain), we actually mean a circulating population of a pathogen of greater or lesser size. Based on one strain (isolate), it is impossible to determine whether it belongs to the hospital category.
It is known that the range of microorganisms circulating in the hospital environment is very diverse. However, only some of their species are capable of forming hospital clones and leading to the development of an epidemic situation. Thus, out of 1263 strains isolated in 21 departments of multidisciplinary hospitals during the examination of 657 patients and 16 employees, as well as during the study of 563 environmental objects, only 36.3% of strains “took part” in the formation of morbidity. According to long-term (more than 20 years) observations and analysis of 112 documented epidemic situations, it was found that the risk of the formation of a hospital clone (strain) exists for a certain group of pathogens: Salmonella typhimurium, S. infantis, S. virchow, S. haifa, Shigella flexneri 2a, Staphylococcus aureus, S. epidermidis, Enterococcus faecalis, E. faecium, Pseudomonas aeruginosa, Burkholderia cepacia, Klebsiella pneumoniae, Escherichia coli, Enterobacter spp., Acinetobacter spp. and a number of others. And although, of course, this list of pathogens can be expanded, the range of microorganisms capable of forming hospital clones is probably limited.
There are also differences in the rate of formation of hospital clones. For example, there is evidence that the period of formation of hospital-
the first clone of S. aureus averaged 93 days, the duration of circulation reached eight months and was limited only when the hospital was completely free of patients. P. aeruginosa was distinguished by the rapid formation of hospital clones (average period - 28 days), circulation of a related strain in the hospital for up to 265 days, and a high rate of colonization. Similar characteristics for K. pneumoniae were 67 and 35 days. It is known that the rate of formation of hospital clones (strains) depends on: the type of pathogen; length of stay of patients in hospital; presence of resistance to certain antibiotics; the intensity of selection processes, determined by the number of patients with purulent processes; the degree of homogeneity of patients according to the nature of the underlying pathology; type of hospital; intensity of microflora exchange between patients.
Thus, each of the characteristics considered is not a necessary and sufficient marker of the strains being hospital-acquired.
Regarding the criteria for determining a hospital clone (strain) of an infectious agent, the current consensus view is as follows:
None of the criteria can be accepted as the only one sufficient to determine the hospital clone (strain).
Determination of a hospital strain and its differentiation from other strains is possible only on the basis of a set of criteria, one part of which is necessary, and the other part is additional.
The set of necessary criteria includes:
Pheno- and genotypic homogeneity of the pathogen population. Only the identity of the characteristics of the isolated pathogen by pheno- and genotype
The clinical characteristics of the population make it possible to classify it as a hospital case; the presence of circulation of this pathogen among patients.
Additional criteria that are significantly more common among hospital clones (strains) may include the presence of genes or virulence factors, antibiotic resistance, resistance to disinfectants and antiseptics, resistance in the external environment, increased adhesiveness, etc. Additional criteria are variable in their manifestations and may be absent, present singly or in a complex, which is determined by the characteristics of the microorganism’s adaptation to the conditions of the artificial hospital ecosystem.
The standard definition of a hospital strain at this stage of development of medical science may look like this:
A population of hospital clones (strains) is a set of individuals of a certain type of microorganisms, homogeneous in pheno- and genotypic characteristics, formed in the hospital ecosystem and adapted to the conditions of the hospital environment.
Hospital strain is a pure culture of a microorganism, isolated from patients, medical personnel or from the external environment, possessing pheno- and genotypic characteristics identical to those of the identified population of hospital microorganisms.
Of course, as scientific data accumulate, the mechanisms for the formation of hospital clones and their epidemic potential, the factors determining the rate of their formation, the necessary and sufficient conditions for circulation, as well as the algorithm for their identification, preventive and anti-epidemic measures will be clarified. w
Literature
Akimkin V.G. Epidemiological surveillance of nosocomial infections and the system of social and hygienic monitoring // Hygiene and Sanitation. 2004. No. 5. P. 19 - 22.
Belyakov V.D., Kolesov A.P., Ostroumov P.B. etc. Hospital infection. - L.: Medicine, 1976. - 231 p. Biological encyclopedic dictionary / Ed. M.S. Gilyarov. 2nd ed., rev. - M.: Sov. encyclopedia, 1986. - 864 p. Borisov L.B., Freidlin I.S. A short reference book of microbiological terminology. - M.: Medicine, 1975. - 136 p.
Brilliantova A.N. Molecular heterogeneity of hospital strains of vancomycin-resistant Enterococcus faecium in hematology: Author's abstract. dis. ... Ph.D. - M., 2010. - 19 p.
Brusina E.B., Rychagov I.P. Epidemiology of nosocomial purulent-septic infections in surgery. - Novosibirsk: Science, 2006. - 171 p. Ginzburg A.L., Shaginyan I.A., Romanova Yu.M. et al. Study of the virulent properties of hospital strains of bacteria of the Burkholderia cepacia complex, isolated in hospitals in Moscow // Zhurn. microbiol. 2005. No. 6. P. 46 - 51.
8. Zakharova Yu.A., Feldblyum I.V. Standard epidemiological definition of an intrahospital strain (ekovar) of a medical institution // Epidemiology and infectious diseases. 2008. No. 6. P. 19 - 23.
9. Zueva L.P., Goncharov A.E., Kolodzhieva V.V. and others. Epidemic strain of methicillin-resistant Staphylococcus aureus in hospitals in St. Petersburg // Journal. microbiol. 2010. No. 5. P. 24 - 29.
10. Kovaleva E.P., Semina N.A. Nosocomial infections in pediatrics // Epidemiology and infectious diseases. 2002. No. 5. P. 4 - 6.
11. Komlev N.G. Dictionary of foreign words. - M.: EKSMO, 2006. - 672 p.
12. Krasilnikov A.P. Microbiological dictionary-reference book. - Minsk: Belarus, 1986. - P. 343.
13. Medical terms-2000 (dic.academic.ru).
14. National concept for the prevention of infections associated with the provision of medical care and information material on its provisions. - N. Novgorod: Remedium, 2012. - 84 p.
Rychagov I.P. Theoretical and organizational foundations for managing the epidemic process of nosocomial infections in surgery: Dis. ... MD - Kemerovo: Kemer. state honey. academic; Scientific reconstruction center and restoration surgery East Sib. scientific Center of the Siberian Branch of the Russian Academy of Medical Sciences, 2007. - 345 p.
Rychagov I.P., Brusina E.B. Management of the epidemic process of nosocomial infections in surgical hospitals // Sterilization and hospital infections. 2007. No. 3. P. 11 - 13.
17. Ryapis L.A. Clonality, phase variability of bacterial species and their connection with manifestations of the epidemic process // Journal. microbiol. 1995. No. 4. P. 115 - 118.
18. Sergevnin V.I., Zueva N.G., Azanov P.B. and others. Resistance to disinfectants and antiseptics by Klebsiella pneumoniae isolated in an obstetric hospital with a non-unit incidence of purulent-septic infections in newborns // Disinfection business. 2011. No. 1. P. 41-45.
19. Dictionary of foreign words. - M.: Rus. language Media, 2007. - 817 p.
20. Feldblum I.V., Zakharova Yu.A. Comparative characteristics of microflora isolated from foci of purulent-septic infections with multiple and isolated cases // Epidemiology and infectious diseases. 2009. No. 35. P. 16 - 21.
21. Feldblum I.V., Zakharova Yu.A. Organizational and methodological foundations of microbiological monitoring aimed at identifying nosocomial strains // Disinfection and antiseptics. 2011. T. 2. No. 4 (8). pp. 22 - 30.
22. Shkarin V.V., Saperkin N.V., Kovalishena O.V. and others. Characteristics of the resistance of microorganisms to chlorine-containing disinfectants and its epidemiological significance // Epidemiology and Vaccinal Prevention. - 2009. No. 5. P. 27 - 31.
23. Shkarin V.V., Blagonravova A.S. Terms and definitions in epidemiology. - N. Novgorod: NGMA Publishing House, 2010. - 300 p.
24. Klare I., Konstabel C., Mueller-Bertling S. et al. Spread of ampicillin/vancomycin-resistant Enterococcus faecium of the epidemic-virulent clonal complex-17 carrying the genes esp and hyl in German hospitals // Eur. J. Clin. Microbiol. Infect. Dis. 2005. V. 24. P. 815 - 825.
25. Linde H., Wagenlehner F., Strommenger B. et al. Healthcare-associated outbreaks and community-acquired infections due to MRSA carrying the Panton-Valentine leucocidin gene in southeastern Germany // Eur. J. Clin. Microbiol. Infect. Dis. 2005. V. 24. P. 419 - 422.
26. Merrer J., Santoli F., Appéré-De-Vecchi C. “Colonization pressure” and risk of acquisition of methicillin-resistant Staphylococcus aureus in a medical intensive care unit // Infect. Control. Hosp. Epidemiol. 2000. V. 21. P. 718 - 723.
27. Siegel J.D., Rhinhart E., Jackson M., Chiarello L. Management of multidrug-resistant organisms in healthcare settings, 2006. Guideline of HICPAC. CDC USA, CDC, 2006. - 74 p.
CONFERENCE
Working meeting of the group of experts on vaccine prevention
The meeting also presented the results of the cohort vaccination of children aged 12 - 24 months with the quadrivalent MMRV vaccine (measles, rubella, mumps and chickenpox), which started after the introduction of vaccination against chickenpox in the National Preventive Vaccination Calendar of Germany (2005), which led to a decrease in morbidity, complications, hospitalization and mortality in other age groups due to the formation of collective immunity. In addition, thanks to the combination vaccine, the number of visits to the doctor for vaccination has decreased and, as a result, medical, social and financial costs have been reduced.
According to experts, the issue of immunization of pregnant women and newborns remains relevant: it is noted that today there is not enough clinical data to better understand the risks/benefits of vaccination of these population groups. Continued clinical research in this area is required (both independent and supported by manufacturers of immunobiological drugs).
In the process of discussing the effectiveness of vaccine prevention of pneumococcal infection, data obtained in Finland, Kenya, Brazil and Canada were presented. Much attention is paid to the correspondence of the vaccine composition to the serological landscape, the immunological effectiveness of polyvalent pneumococcal conjugate vaccines, as well as the mechanism of formation of cross-immunity to pneumococcal serotypes not included in the drug. The importance of starting early vaccination (in the first 6 months of life) is noted; data is provided
Another interesting issue discussed at the meeting was the prevention of meningococcal infection, taking into account the change in serological groups of the pathogen during outbreaks and the rationale for using a drug with the maximum number of meningococcal serogroups. The advantages and disadvantages of conjugate meningococcal vaccines compared to existing (polysaccharide) vaccines, the duration and intensity of immunity, safety and effectiveness when combined with other vaccines, in particular those used by travelers (against yellow fever), are highlighted. Thus, it was noted that vaccination against meningococcal infection of children at the age of 9 months with the introduction of a booster dose at 12 months (formation of early protection) is included in the National Calendar of Preventive Vaccinations of Saudi Arabia. Experts are confident that this strategy will bring additional benefits, especially in the context of the annual Hajj mass events.
All participants expressed the general opinion that such a forum allows experts to exchange views and results of the implementation of new programs and discuss possible strategies adopted in different countries that could lead to improved vaccine programs in general.
The information was prepared by Prof. E.P.
